dmso natures healer pdf free download

Dimethyl sulfoxide (DMSO) is currently used as an alternative treatment for various inflammatory conditions as well as for cancer. Despite its widespread use, there is a paucity of data regarding its safety and efficacy as well as its mechanism of action in human cells. Herein, we demonstrate that DMSO has ex-vivo anti-inflammatory activity using Escherichia coli- (E. coli) and herpes simplex virus-1 (HSV-1)-stimulated whole human blood. Specifically, we found that between 0.5%- 2%, DMSO significantly suppressed the expression of many pro-inflammatory cytokines/chemokines and prostaglandin E2 (PGE2). However, a significant reduction in monocyte viability was also observed at 2% DMSO, suggesting a narrow window of efficacy. Anti-inflammatory concentrations of DMSO suppressed E. coli-induced ERK1/2, p38, JNK and Akt phosphorylation, suggesting DMSO acts on these signaling pathways to suppress inflammatory cytokine/chemokine production. Although DMSO induces the differentiation of B16/F10 melanoma cells in vitro, topical administration of DMSO to mice subcutaneously implanted with B16 melanoma cells was ineffective at reducing tumor growth, DMSO was also found to block mouse macrophages from polarizing to either an M1- or an M2-phenotype, which may contribute to its inability to slow tumor growth. Topical administration of DMSO, however, significantly mitigated K/BxN serum-induced arthritis in mice, and this was associated with reduced levels of pro-inflammatory cytokines in the joints and white blood cell levels in the blood. Thus, while we cannot confirm the efficacy of DMSO as an anti-cancer agent, the use of DMSO in arthritis warrants further investigation to ascertain its therapeutic potential.

Content may be subject to copyright.

Discover the world's research

20+ million members
135+ million publications
700k+ research projects

Join for free

RESEARCH ARTICLE

DMSO Represses Inflammatory Cytokine

Production from Human Blood Cells and

Reduces Autoimmune Arthritis

Ingrid Elisia

, Hisae Nakamura

, Vivian Lam

, Elyse Hofs

, Rachel Cederberg

Jessica Cait

, Michael R. Hughes

, Leora Lee

, William Jia

, Hans H. Adomat

, Emma

S. Guns

, Kelly M. McNagny

, Ismael Samudio

, Gerald Krystal

1The Terry Fox Laboratory, British Columbia Cancer Agency, Vancouver, B.C., Canada, 2The Biomedical

Research Centre, University of British Columbia, Vancouver, B.C., Canada, 3 The Brain Research Centre,

University of British Columbia, Vancouver, B.C., Canada, 4 The Vancouver Prostate Centre at Vancouver

General Hospital, Vancouver, B.C., Canada

*gkrystal@bccrc.ca

Abstract

Dimethyl sulfoxide (DMSO) is currently used as an alternative treatment for various inflam-

matory conditions as well as for cancer. Despite its widespread use, there is a paucity of

data regarding its safety and efficacy as well as its mechanism of action in human cells.

Herein, we demonstrate that DMSO has ex-vivo anti-inflammatory activity using Escherichia

coli-( E.coli) and herpes simplex virus-1 (HSV-1)-stimulated whole human blood. Specifi-

cally, we found that between 0.5%–2%, DMSO significantly suppressed the expression of

many pro-inflammatory cytokines/chemokines and prostaglandin E

(PGE

). However, a

significant reduction in monocyte viability was also observed at 2% DMSO, suggesting a

narrow window of efficacy. Anti-inflammatory concentrations of DMSO suppressed E . coli-

induced ERK1/2, p38, JNK and Akt phosphorylation, suggesting DMSO acts on these sig-

naling pathways to suppress inflammatory cytokine/chemokine production. Although

DMSO induces the differentiation of B16/F10 melanoma cells in vitro , topical administration

of DMSO to mice subcutaneously implanted with B16 melanoma cells was ineffective at

reducing tumor growth, DMSO was also found to block mouse macrophages from polarizing

to either an M1- or an M2-phenotype, which may contribute to its inability to slow tumor

growth. Topical administration of DMSO, however, significantly mitigated K/BxN serum-

induced arthritis in mice, and this was associated with reduced levels of pro-inflammatory

cytokines in the joints and white blood cell levels in the blood. Thus, while we cannot confirm

the efficacy of DMSO as an anti-cancer agent, the use of DMSO in arthritis warrants further

investigation to ascertain its therapeutic potential.

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 1/24

OPEN ACCESS

Citation: Elisia I, Nakamura H, Lam V, Hofs E,

Cederberg R, Cait J, et al. (2016) DMSO Represses

Inflammatory Cytokine Production from Human Blood

Cells and Reduces Autoimmune Arthritis. PLoS ONE

11(3): e0152538. doi:10.1371/journal.pone.0152538

Editor: Paul Proost, University of Leuven, Rega

Institute, BELGIUM

Received: January 19, 2016

Accepted: March 15, 2016

Published: March 31, 2016

access article distributed under the terms of the

Creative Commons Attribution License, which permits

unrestricted use, distribution, and reproduction in any

medium, provided the original author and source are

credited.

Data Availability Statement: All relevant data are

within the paper and its Supporting Information files.

Funding: This work was funded by the Lotte and

John Hecht Memorial Foundation to GK, Hecht Grant

ID #3693 (http://www.hecht.org ). The funders had no

role in study design, data collection and analysis,

decision to publish or preparation of manuscript.

Competing Interests: The authors have declared

that no competing interests exist.

Abbreviations: Arg-1, arginase 1; DMS, dimethyl

sulfide; DMSO, dimethyl sulfoxide; DMSO

dimethylsulfone; E. coli , Escherichia coli ; GPI,

Introduction

Dimethyl sulfoxide (DMSO, i.e., (CH

)

SO)), by virtue of its one highly polar sulfinyl group and

two non-polar methyl groups, is considered an excellent solvent, capable of dissolving many

polar and non-polar compounds [1,2 ]. It is widely available and inexpensive because it is easily

generated from dimethyl sulfide (DMS), a byproduct of the pulp and paper industry [3 ]. DMSO

has also been used for many years to cryopreserve cells for both research and clinical applica-

tions since it prevents ice crystal formation and thus reduces cell death [4 ]. Its medicinal use

was first promoted by Stanley Jacob, who reported in 1964 that DMSO easily penetrates the skin

and carries small molecules through biological membranes [5 ]. Since then, a large number of

publications have reported a wide range of other biological activities that suggest the potential

use of DMSO as a versatile pharmacotherapy agent in a variety of medical conditions ranging

from acute musculoskeletal disorders, arthritis, scleroderma, headaches and cancer [6–9 ]. In

1965, however, the FDA banned all clinical trials involving DMSO because it was found to cause

changes in the refractive index of the lens in the eyes of a number of animals [10 ]. Although the

regulatory restriction to conduct clinical trials on DMSO was lifted in 1980, the feverish research

interest in DMSO seen in the 1960s has not been rekindled [11 ,12 ]. As a result, there have been

very few recent studies to validate its safety and efficacy in various clinical settings.

Currently, the only US FDA approved medical use for DMSO is for the treatment of inter-

stitial cystitis, via intravesicular administration of a 50% DMSO solution [2 ]. The FDA is leery

of extending its use to other indications and lists it as a " fake cancer cure" [13 ]. Nonetheless, a

quick internet search for " medicinal uses of DMSO" reveals that it is currently being used

extensively, orally, topically and even intravenously, as an alternative treatment for a wide vari-

ety of conditions, including pain, wound healing, inflammatory disorders, viral infections and

cancer [14 ]. Given its wide, unsanctioned use today and a paucity of data concerning its safety

and efficacy, we have, herein, undertaken studies to evaluate DMSO as an anti-inflammatory

agent using a novel whole human blood assay designed to measure the ability of blood cells, ex

vivo, to respond to a bacterial and viral challenge. In addition, we have investigated the mecha-

nism(s) by which DMSO modulates the production of pro-inflammatory cytokines/chemo-

kines from human monocytes, the predominant cell in human blood that secretes these

inflammatory mediators. Lastly, given its promotion as an alternative medicine for both cancer

[15 ] and inflammatory disorders [ 16 , 17 ] we examined its effects in vivo , via topical application

to mouse models of human melanoma and rheumatoid arthritis.

Materials and Methods

Reagents

The IL-6 ELISA kit was from BD Biosciences (Mississauga, ON, Canada) and the human cyto-

kine/chemokine Luminex

Multiplex Immunoassay kit and One Shot

INV110 chemically

competent Escherichia coli ( E . coli ) was from Life Technologies (Burlington, ON). The Prosta-

glandin E

(PGE

) EIA kit was from Cayman Chemical Company (Ann Arbor, MI). Antibodies

for Western blotting for phospho-JNK (#9255), phospho-p38 (#9212), and phospho-ERK1/2

(#9106S), and the MEK inhibitor U0126, were from Cell Signaling Technology (Beverly, MA,

USA). Antibodies recognizing phospho-Akt (44-621G) were from Invitrogen/Life Technolo-

gies (Grand Island, NY, USA) and for Grb2 (sc-255) from Santa Cruz Biotechnology (Santa

Cruz, CA. USA). DMSO (D8418), DMSO

(M81705), and DMS (274380) were from Sigma-

Aldrich (St Louis, MO). The NF-κ B inhibitor Bay11-7082 (Bay11), the p38 inhibitor

SB203580, and the PI3K inhibitor LY294002 were from Calbiochem (San Diego, CA), while

the JNK inhibitor SP600125 was from EMD Millipore (Etobicoke, ON). Herpes simplex virus-

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 2/24

glucose-6-phosphate isomerase; HSV-1, herpes

simplex virus-1; IL-1β , interleukin-1β; iNOS, inducible

nitric oxide synthase; IP, intraperitoneal; LPS,

lipopolysaccharide; mФ s, macrophages; MIP-1α ,m Ф

inflammatory protein; MTG, monothioglycerol; NO,

nitric oxide; PBMCs, peripheral blood mononuclear

cells; PGE

, prostaglandin E

; TLR, toll like receptor;

wbc, white blood cell.

1 (HSV-1) G207 was from W.J. Ammonium chloride solution, EasySep™ Human Monocyte

Enrichment Kit without CD16 depletion, and RPMI 1640 culture media were from StemCell

Technologies (Vancouver, Canada). Human AB serum was from Innovative Research (Novi,

MI, USA). The melanoma B16/F10 cell line was a kind gift from Dr. Youwen Zhou of the Der-

matology department at the University of British Columbia (UBC).

Mice

Mice were bred in-house and boarded in specific pathogen free facilities at the Animal

Resource Centre, BC Cancer Research Centre or the Biomedical Research Centre at UBC. All

experiments and protocols were approved by and performed according to the requirements of

the Canadian Council on Animal Care (CCAC) and the University of British Columbia Animal

Care Committee (protocol # A14-0175 (GK) and #A14-0115 (KM)). KRN mice (generously

provided by Dr. David M. Lee from Brigham and Women' s Hospital and Harvard Medical

School, Boston, MA) were bred with NOD-SCID IL2Rγ

-/-

mice (JAX #005557) to yield K/BxN

mice. K/BxN mice were sacrificed at 12 weeks of age to harvest arthritogenic K/BxN serum by

cardiac puncture. Eight to 10 week old C57BL/6J (JAX#000664) (B6) were used for all other

mouse experiments unless otherwise stated.

Human Whole Blood Assay

All experiments performed on human blood were reviewed and approved by the University of

British Columbia Clinical Research Ethics Board (#H12-00727). Human blood was collected by

phlebotomists from volunteers, who gave written consent to participate in this study, into endo-

toxin-free, heparin-coated tubes. Fifty microlitres of blood was aliquoted into round bottom 96

well plates, to which 10 μ L of DMSO, diluted in PBS, was added or not. After 15 min of incuba-

tion at 37°C in a low oxygen (5% O

) incubator, inflammatory responses were initiated by the

addition of E . coli (10

/mL), or HSV-1 (MOI = 2), (total volume = 70 μ L/well), followed by incu-

bation for 7 h at 37°C. 100 μ L of PBS was then mixed well with the blood samples and the plate

centrifuged at 335 x g using an SX4750 Rotor in an Allegra X-12R centrifuge for 5 min. Superna-

tants were immediately frozen at -80°C for subsequent ELISAs and Luminex analyses.

Measurement of Cytokine, Chemokine and PGE

Levels

IL-6 levels in plasma were determined by ELISA, according to the manufacturer' s instructions

and results are expressed as a percent of the IL-6 level triggered by non-DMSO-treated blood

samples in the absence (0%) or presence (100%) of E . coli or HSV-1. PGE

in plasma was quan-

tified using a PGE

EIA kit according to the manufacturer' s instructions. Luminex analyses to

simultaneously quantify the levels of IL-1β , G-CSF, IL-10, IL-13, IL-6, IL-17, MIP-1α (CCL3),

VEGF, IFNγ , IL-12p70, IFNα, IL-1RA, TNF-α , IL-4 and IL-8 (CXCL8) were performed using a

Luminex 100 Bio-Plex Microplate Analyzer (Bio-Rad Laboratories, Hercules, CA). Acquired

fluorescence was analyzed by the Bio-Plex Manager™ version 6.0 (Bio-Rad Laboratories).

DMSO, DMS and DMSO

To compare the relative efficacy of DMSO with its metabolites, DMS and DMSO

, on modulat-

ing inflammatory responses, the 3 compounds were analyzed in the whole blood assay as

described above. The three compounds were dissolved in autologous plasma instead of PBS to

increase the solubility of DMS in the whole blood assay. Also, to prevent the volatile DMS from

affecting the evaluation of other treatments (DMSO and DMSO

), the 96 well plate was sealed

with a plate sealer during the 7 h incubation period.

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 3/24

Cell Viability Assays

In parallel studies, whole human blood samples (70 μ L/well) were collected at the end of the 7

h incubation period to determine the effect of DMSO, DMSO

and DMS on cell viability using

propidium iodide staining. Specifically, following the 7 h incubation assay, red blood cells were

lysed by the addition of 2.5 mL of ammonium chloride solution (StemCell Technologies) in

polystyrene flow tubes. After 15 min of incubation on ice, cells were pelleted by centrifugation

at 335 x g for 5 min, followed by a wash step with cold PBS containing 2% FBS and 0.05%

sodium azide (HFN). Cells were then stained with 1 μ g/mL propidium iodide in 300 μ Lof

HFN and subjected to flow cytometric analysis using a FACSCalibur (Becton Dickinson).

Fractionation of Blood Cells

Cells were fractionated from whole blood by Ficoll density gradient centrifugation. Neutrophils

were recovered from the granulocyte layer, which was subjected to ammonium chloride lysis to

remove red blood cells. Peripheral blood mononuclear cells (PBMCs) were collected from the

buffy coat, reconstituted in 50% autologous plasma and seeded at 4.5x10

cells/50 μ L into flat

bottom 96 well plates. Monocytes were obtained from PBMCs by adherence of the cell mixture

to a flat bottom 96 well plate for 1h in a 37°C incubator. The non-adhering lymphocytes were

collected and seeded in 50% autologous plasma in separate wells. The monocytes, lymphocytes

and neutrophils were then challenged with E . coli as described above. After 7 h of incubation,

the plates were centrifuged as above and the supernatants collected for IL-6 analysis.

Cell Signaling in Human Monocytes

White blood cells collected by apheresis from G-CSF-mobilized normal stem cell donors were

obtained from the Stem Cell Assay Laboratory/Hematology Cell Bank of the British Columbia

Cancer Agency. Monocytes from these apheresis samples were then isolated using an EasySep

kit according to the manufacturer' s instructions and assessed as > 92% CD14

by flow cytome-

try or by adherence. They were seeded at 2 x 10

cells/well in flat bottom 12 well plates in

serum-free RPMI 1640 medium. After 2 h at 37°C, the serum-free medium was removed and 1

mL RPMI 1640 medium ± DMSO (at a final concentration of 2%) was added to the cells. After

15 min at 37°C, the cells were challenged with E . coli (at a final concentration 2x10

/mL) for 15

and 30 min. Whole cell lysates were prepared for Western blotting by washing cells once with

cold PBS followed by the addition of SDS sample buffer (1x) to the cell pellets. The samples

were sheared with a 26G needle prior to boiling for 1 min. Whole cell lysates in SDS sample

buffer were loaded onto 10% polyacrylamide gels. Upon transfer to PVDF membranes, sepa-

rated proteins were probed for p-Akt, p-p38, p-JNK, p-ERK1/2 and Grb-2. Primary antibodies

were used at 1/1000 dilution, and Grb-2 was used as a loading control.

To establish the importance of specific cell signaling pathways to the production of pro-

inflammatory cytokines from LPS-stimulated human monocytes, the NF-κ B inhibitor, Bay11,

the p38 inhibitor, SB203580, the PI3K inhibitor, LY294002, and the JNK inhibitor, SP 600125,

were added to adherent human monocytes cultured in RPMI 1640 containing 10% AB+ serum

in flat bottom 96 well plates. After 15 min at 37°C, the cells were challenged with E . coli (final

concentration 10

/mL) for 7 h. Supernatants were recovered and IL-6 levels determined by

ELISA as above.

Differentiation of B16/F10 Cells

Mouse melanoma B16/F10 cells were seeded at 2.5 x 10

cells/10 mL media in 100 mm culture

plates. After overnight incubation, DMSO was added at a final concentration of 0, 1, and 1.5%

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 4/24

and the plates incubated for 6 days at 37°C. The cells were harvested by trypsinization, washed

once with PBS, and cell numbers adjusted to 7x10

cells/mL with 1M NaOH containing 10%

DMSO. The melanin content was extracted as described in [18 ] using a modified protocol in

which the cells were heat-treated at 80°C for 2 h, followed by centrifugation at 16,060 x g in a

Heraeus Biofuge pico microcentrifuge. Supernatants were recovered and optical densities mea-

sured at 400 nm in a Multiscan plate reader (Labsystem, Finland).

In Vivo Melanoma Assay

Logarithmically growing (< 50% confluency) mouse melanoma B16/F10 cells were harvested

by trypsinization, washed twice with ice-cold HBSS and resuspended in cold PBS at 5x10

cells/mL [19 ]. They were then subcutaneously implanted (5x10

in 100 μ L PBS) into the shaved

backs of 16 isoflurane anesthetized, female C57BL/6 mice. The treatment group received topi-

cal administration of 70% DMSO dissolved in sterile water (i.e., 1 mL in a 2" x2 "Dermacea

gauze sponge, folded in four), 4 times/day, starting immediately after tumour implantation

(day 0). The control group received topical administration of sterile water instead of 70%

DMSO. The gauze pads soaked in either 70% DMSO or water were manually placed on the

shaved backs of the mice for 1 min per treatment period. To prevent mice from licking the

DMSO off each other, individual mice were isolated for 30 min while the DMSO dried by plac-

ing them in custom-made cages with plastic partitions that separated the cage into quadrants

after every treatment. The mice were then placed back in their original cages. Tumor sizes were

measured daily with manual calipers, and tumor volumes calculated using the formula

(Length × Width × Height) × π /6. All mice were euthanized 12 days after tumor implantation

and blood was obtained via cardiac puncture to determine plasma IL-6 levels. Tumors were

excised and weighed.

Macrophage Polarization Assays

Murine bone marrow derived macrophages (mФ s) were polarized to classically (M1) or alter-

natively (M2) activated mФ s according to Weisser et al [20 ]. Briefly, bone marrow cells were

aspirated from 8– 12 week old C57Bl6 mice and differentiated in GM-CSF (10 ng/mL) or

M-CSF (12 ng/mL)-containing Iscove' s Modified Dulbecco' s Medium in the presence of

150 μ M monothioglycerol (MTG) and 10% FCS. The cells were differentiated for 10 days with

media changes at days 3 and 7. At day 10, cells were re-plated in a 12 well plate at 5x10

cells/

well and treated with DMSO at final concentrations of 0.25% to 1%. To polarize mФ stoanM1

phenotype, GM-CSF-differentiated cells were stimulated with LPS at 100 ng/mL for 24 hrs, ±

DMSO. For M2 skewing, M-CSF differentiated mФ s were treated with IL-4 (10 ng/mL) for 48

hrs ± DMSO. Cells were then washed once with PBS, resuspended in SDS sample buffer (1x) as

described above and subjected to Western blot analysis. M2-skewed m Ф lysates were probed

for Arg-1 and Ym-1 while M1 skewed mФ lysates were probed for iNOS. Grb-2 was used as a

loading control.

Nitric oxide (NO) levels in M1 skewed mФ s were measured by mixing 100 μ L of cell super-

natant with 100 μ L of Griess reagent. The absorbances of the samples were measured at 540

nm using a Sunrise™ Tecan spectrophotometer (Switzerland)

In Vivo Arthritis Model

Arthritis was induced in 10– 12 week old male C57BL/6 mice by two intraperitoneal (IP) injec-

tions of 100 μ L of K/BxN serum (generated in-house) on days 0 and 2 [21 ]. One day (24 h)

before the initial IP injection of K/BxN serum, the hind paws of the mice were dipped for 30 s

per paw in a 70% DMSO/30% autoclaved water solution (or autoclaved water alone as a

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 5/24

control). Hind paws were fully immersed up to the ankle fur line using a 50 mL falcon tube lid

filled to capacity. The thickness of hind ankle and fore paws was measured daily using a dial

thickness gauge (Mitutoyo 7305, with 0.01 mm graduations from KBC Tools, Vancouver, BC).

At the same time, a clinical score for each paw was assigned as previously described [22 ] with

slight modifications: 0 = no sign of swelling, 1 = mild swelling and/or redness, 2 = swelling of

ankle and midfoot/paw, 3 = swelling involving the whole joint and midfoot/paws, and 4 = severe

swelling encompassing the ankle, foot/paw and fingers/toes. Daily clinical score and ankle

thickness measurements of the hind and/or fore paws were summed up together and compared

to baseline scores/measurements. On day 7, mice were euthanized by CO

asphyxiation.

Plasma was collected immediately after sacrifice by cardiac puncture using a syringe containing

20 μ L of 0.5 M EDTA. The skin covering the joints was removed and whole joints were snap-

frozen in dry ice and stored at -80°C for later analysis or fixed for histology as described below.

Quantitative PCR

The gene expression levels of IL-6, TNFα , IL-1β, CXCL1, and CXCL2 in the joints were deter-

mined by real time qPCR. RNA isolation from crushed tissue joints was performed after bead

mill homogenization of the joints in 1 mL of Trizol. RNA was quantified using a ND1000

nanodrop spectrophotometer and cDNA was synthesized from 2 μ g of RNA using a High

Capacity cDNA Reverse Transcription kit (Applied Biosystems). cDNA was mixed with SYBR

FAST (qPCR kit, KAPA Biosystems) and primers specific to the genes of interest (listed in

Table 1). PCR amplification was performed on an ABI 7900 HT instrument (Applied Biosys-

tems, Foster City, CA, USA). The mRNA expression level of the genes of interest was expressed

relative to Gapdh transcript levels.

Determination of DMSO levels

The DMSO concentration in plasma and joints was quantified using HPLC/MS. Deuterated

DMSO (d

-DMSO) was used as an internal standard. Plasma samples were diluted with aceto-

nitrile containing internal standard, vortexed, centrifuged for 5 min at 15,000 x g and superna-

tants transferred to LC vials. DMSO from crushed joints was extracted by the addition of 9

volumes of acetonitrile to the joints. The samples were vortexed, incubated at 4°C overnight,

and centrifuged at 16,060 x g in a Heraeus Biofuge pico microcentrifuge for 10 min. Superna-

tants were analyzed for DMSO content in an identical fashion to that performed for plasma

samples. Samples were analyzed with a Waters Acquity LC coupled to a Waters Quattro Pre-

mier using a BEH Amide, 1.7μ column (Waters). Water (0.1% formic acid (FA)) and ACN

(0.1% FA) were LC solvents A and B, respectively. Gradient runs were performed as follows:

94% B at 0– 1.1min; 94– 50% B at 1.1–1.2min; 50% B at 1.2– 2.6min; 50– 94% B at 2.6– 2.7min

with total run length 5.5min at 0.4mL/min. All MS data were collected in ES+ at unit resolution

Table 1. Primers for real time gene expression analysis.

Gene name Forward (5'-3 ' ) Reverse (5'-3 ' )

Gapdh CGTGCCGCCTGGAGAAACC TGGAAGAGTGGGAGTTGCTGTTG

Il6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC

Tnfa CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC

Il1b GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT

Cxcl1 CTGGGATTCACCTCAAGAACATC CAGGGTCAAGGCAAGCCTC

Cxcl2 AGTGAACTGCGCTGTCAATGC CCATCCAGAGCTTGACGGTGAC

doi:10.1371/journal.pone.0152538.t001

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 6/24

with the following parameters: capillary, 3.5kV; extractor and RF lens, 5V and 0.2V; source and

desolvation temperatures, 120°C and 350°C; desolvation and cone (N

) flow, 1000L/hr and 50

L/hr; collision gas (Ar) flow, 0.17ml/min (8.1e

-3

m bar). Detection was by multiple reaction

monitoring with m/z 79> 64 for DMSO and m/z 85> 67 for d

-DMSO (35V/14V cone/collision

volt for both) with 0.1sec dwell each and 1.06 min retention time (RT) for both. Quantitation

was via the AUC ratio of DMSO/d6-DMSO with a linear fit through calibration data

>0.99); accuracy/precision >±15% (n = 3) above 50 nM.

Blood Differential Analysis and Joint Lavage

To identify the effect of topical administration of DMSO on circulating blood cells and

immune cells recruited to the joints, blood samples were obtained by cardiac puncture, and

joint lavage was carried out to recover immune cells. Briefly, the hind paws of 18 week old

female C57BL/6NHsd were immersed in 100% DMSO or distilled water for 1 min, twice daily,

beginning 48 h prior to K/BxN serum injection (100 μ L IP at day 0 and day 2). DMSO or

water-treated mice that were IP injected with PBS instead of K/BxN serum served as controls.

Mice were sacrificed at day 3 and exactly 300 μ L blood was collected via cardiac puncture into

EDTA-containing tubes (20 μ L of 0.5 M EDTA). Complete blood count of blood was per-

formed using a scil Vet animal blood counter hematology analyzer (Viernheim, Germany).

The immune infiltrate in the joints was determined by joint lavage as described [22 ] The cells

in the joint lavage were subsequently stained with a viability marker (7AAD) (ThermoFisher

Scientific, Waltham, MA, USA), CD45.2-eFluor450 (clone 104 from ebioscience, San Diego,

CA, USA), 7/4-FITC (ab53453 from Abcam, Toronto, ON, Canada) and Gr-1-PE (clone RB6-

8C5 from AbLab.ca, Vancouver, BC) to identify polymorphonuclear (PMN) cells, by flow

cytometry (LSR II, BD Bioscience, San Jose, CA, USA) using FlowJo software (FlowJo, Ashland,

OR, USA) for data analysis. Pre-calibrated counting beads (ThermoFisher Scientific) were

added to the final flow cytometry sample tubes to determine the total live cells recovered from

the joints.

Results

DMSO is Anti-inflammatory in a Whole Human Blood Assay

Given DMSO' s rapid uptake into the blood stream [23 ] we first examined its effects on whole

human blood, optimized, ex vivo , to mimic in vivo conditions as closely as possible. Specifically,

we used whole human blood rather than isolated PBMCs, which have been used extensively in

the past for cytokine/chemokine expression studies [24,25 ], in order to eliminate potential arti-

facts that might result from lengthy isolation procedures and to mimic in vivo conditions more

closely since red blood cells, granulocytes and plasma are still present. In addition, we have

incubated whole blood samples under physiological levels of oxygen (5% rather than 21%) at

37°C for 7 h (to minimize changes in the properties of the blood cells that might occur with

longer in vitro incubation times). Preliminary studies in our lab have shown that this time

period is sufficient to detect both early and late secreted cytokines and chemokines from leuko-

cytes in whole blood assays (data not shown). We have also challenged our whole blood sam-

ples with either intact bacterial (E . coli ), or virus (HSV-1), rather than specific Toll like

receptor (TLR) agonists like lipopolysaccharide (LPS), since we considered intact pathogens

more representative of in vivo infections.

As shown in Fig 1A , DMSO dose response studies with whole human blood samples from

healthy volunteers, challenged with E . coli, revealed that final concentrations of 0.25% DMSO

modestly but consistently increased IL-6 production whereas, concentrations of 1% and greater

were inhibitory. In addition, DMSO at 0.5% and higher significantly suppressed PGE

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 7/24

Fig 1. The effect of DMSO on the (A) IL-6, (B) PGE

and (C) 15 cytokine/chemokine secreted in a whole human blood assay in response to E. coli or

(D) HSV stimulation. * denotes significant difference (P < 0.05) from non-DMSO treated, E. coli challenged or HSV-stimulated blood.

doi:10.1371/journal.pone.0152538.g001

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 8/24

secretion from E . coli -stimulated whole blood cells (Fig 1B ), confirming the anti-inflammatory

activity of DMSO in a whole human blood assay.

DMSO Modulates both Bacterial and Viral Stimulated Cytokines

To expand on these findings we used Luminex technology to determine the effect of DMSO on

the E . coli -stimulated secretion of a total of 15 cytokines/chemokines from normal human

whole blood cells. As shown in Fig 1C , 2% DMSO significantly reduced the levels of 13 of the

cytokines/chemokines. The two notable exceptions were interleukin-1β (IL-1β ), the only ana-

lyte within this panel that is cleaved/matured in the inflammasome [26 ] and mФ inflammatory

protein (MIP-1α ), the only analyte tested that is a member of the C-C family of pro-inflamma-

tory chemokines [27 ]. Also of note, lower concentrations (0.5% and/or 1%) of DMSO actually

promoted the expression of these two analytes, suggesting a potentially distinct effect of DMSO

on different cell signaling pathways. Importantly, some analytes were far more sensitive to

DMSO-induced inhibition. G-CSF and IFNγ , for example, were extremely sensitive, showing

substantial reductions at 0.5% DMSO (see below).

We also used Luminex technology to ascertain the effect of DMSO on the secretion of these

15 cytokines/chemokines from virally (i.e., HSV-1) stimulated normal human whole blood

cells. As shown in Fig 1D , IL-1β and MIP1α were, once again, not inhibited by 2% DMSO and,

in fact, IL-1β levels were dose dependently increased with DMSO. As well, G-CSF and IFNγ

were extremely sensitive to inhibition by DMSO. IFNα levels were stimulated to far higher lev-

els with HSV-1 than E . coli , which is expected since this cytokine is typically secreted during

viral infections [28 ]. This too, was markedly inhibited with only 0.5% DMSO. The effect of

DMSO on these analytes, triggered by either E . coli or HSV-1 is more clearly shown in Fig 1E,

where we have expanded the Y ordinate.

Cytotoxicity of DMSO

To determine if the DMSO-induced reductions in cytokine/chemokine production were due to

cytotoxic effects on blood cells, its effect on blood cell death was determined by propidium

iodide staining. As shown in Fig 2A , 7 h of treatment with DMSO was not cytotoxic to blood

cells when tested at final concentrations up to 1% and only slightly, but significantly (P<0.05)

cytotoxic at 2% to 5%, where it reduced cell viability by 4.7 to 7.8%, respectively. However,

when the concentration of DMSO was increased to 10%, cell death was dramatically increased

to 86.4% which also corresponds to the concentrations at which extensive hemolysis was

observed (data not shown), in keeping with previous studies [29 ]. Of note, when the effects of

DMSO on the viability of white blood cell (wbc) subtypes was examined, monocytes were more

sensitive than granulocytes or lymphocytes, with viability beginning to decrease at a final

DMSO concentration of 1%, whereas granulocyte and lymphocyte viability did not signifi-

cantly decrease until levels between 5 and 10% (Table 2 ). At 10% DMSO, all wbc subsets were

drastically decreased, which corresponds to the overall PBMC toxicity observed with PI stain-

ing and flow cytometry (Fig 2A ). These results suggest that DMSO has a narrow therapeutic

concentration range between efficacy as an anti-inflammatory agent and cytotoxicity to the

cells that produce the bulk of the cytokines/chemokines (i.e., monocytes, see below).

The Effect of DMSO Metabolites on IL-6 Production

DMSO generates two major metabolites in vivo , the highly volatile, malodorous DMS, respon-

sible for the garlic taste that occurs after DMSO administration and the oxidized DMSO deriv-

ative, DMSO

[16 ]. A previous study examining the kinetics of their appearance and clearance

in humans revealed that neither of these derivatives ever reaches the blood concentration of

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 9/24

Fig 2. (A) The dose dependent effect of DMSO on human blood cell viability. After 7 h of incubation, red blood cellswere lysed with ammonium chloride and

the white blood cells stained with propidium iodide and analysed by flow cytometry. * denotes significant difference (P < 0.05) from non-DMSO treated, E . coli

challenged blood. (B) The effects of DMSO, DMS and DMSO

on E.coli -stimulated production of IL-6 in the human whole blood assay. (C) A comparison of

E.coli-induced cytokine/chemokine production from monocytes, lymphocytes and granulocytes. Data are expressed as mean ± SD of triplicate

determinations from 1 experiment representative of 2 or 3 independent experiments with bloodfrom different healthy donors. (-) and (+) refers to treatment of

cells without and with E . coli , respectively.

doi:10.1371/journal.pone.0152538.g002

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 10 / 24

DMSO [23 ]. Nonetheless, to determine if they might play a role in the anti-inflammatory prop-

erties attributed to DMSO and we compared their ability to modulate IL-6 production from E.

coli stimulated human blood. As shown in Fig 2B , DMSO

and DMS were less effective than

DMSO in reducing E . coli -induced IL-6 production. Of note, at concentrations less than 2%,

DMS induced the most hemolysis as well as the most wbc death, while DMSO

was similar to

DMSO in its induction of cell death in the 7 hr blood assay, as demonstrated by propidium

iodide staining and flow cytometry (data not shown).

The Effect of DMSO on Cell Signaling Pathways

To identify which of the three major wbc subtypes, (monocytes, lymphocytes or granulocytes),

was responsible for the majority of the inflammatory cytokines/chemokines produced in

response to E .coli challenge in the whole human blood assay, these three subtypes were sepa-

rated and challenged with E . coli . As shown in Fig 2C , monocytes were the only cellular fraction

that produced detectable IL-6 in response to E . coli stimulation. Luminex studies showed that

this was also the case for the other 14 cytokines/chemokines (data not shown). We therefore

focused on human monocytes to gain some insight into how DMSO was reducing cytokine/

chemokine production. Since previous reports have shown that LPS activation of human

monocytes leads to the phosphorylation of both the PI3K and the three MAPK (i.e. p38, JNK

and ERK1/2) pathways [30 ] we first examined the effect of E . coli on these pathways in human

monocytes. As shown in Fig 3A , after 30 min of E. coli stimulation, Akt, p38, JNK and ERK1/2

were all phosphorylated [30 ]. Importantly, in the presence of 2% DMSO, there was a marked

reduction in the phosphorylation of all of them. We then followed up these studies with various

pathway inhibitors using U0126, LY294002 and SB203580 to inhibit the ERK, PI3K and p38

signaling pathways, respectively. All appear to be involved in IL-6 production from E . coli chal-

lenged human monocytes with the exception of JNK; we saw no differences in the presence of

SP600125 (Fig 3B ). Of note, the NFκ B inhibitor, Bay 11, also markedly inhibited IL-6 produc-

tion from E . coli challenged human monocytes (Fig 3B ), consistent with previous reports show-

ing the importance of this transcription factor to inflammatory cytokine production in TLR

agonist-stimulated human monocytes [30 ]. In addition, PP2 which is an inhibitor of the Src

family was also effective in reducing IL-6 production and this appeared to be mediated through

inhibition of the PI3K pathway, since PP2 reduced Akt phosphorylation, but not Erk phos-

phorylation (data not shown).

DMSO Does Not Reduce the In Vivo Growth Rate of Melanomas

DMSO is currently used as an alternative treatment for various cancers. To assess its efficacy as

an anti-cancer agent we used the B16 melanoma mouse model since it is both amenable to topi-

cal treatment and potentially relevant to treating human cancers topically. Preliminary in vitro

Table 2. The effect of DMSO on white blood cell subtypes stimulated with E. coli in the human whole blood assay.

Control E. coli 0.25% 0.5% 1% 2% 3% 5% 10%

Granulocytes 56.2 ± 1.1 55.2 ±2.3 52.8 ±1.7 47.8 ± 1.4* 48.7 ± 2.2* 46.9 ± 7.8 52.5 ± 3.0 58.2 ±0.7 27.1 ± 1.2*

Lymphocytes 32.1 ± 0.4 34.6 ±1.9 36.6 ±1.5 41.0 ± 1.2* 39.1 ± 1.6* 43.7 ± 8.1 36.6 ±2.3 27.8 ± 0.8* 15.6 ± 1.0*

Monocytes 7.9 ±0.3 6.8 ± 0.3 7.8 ± 0.5* 7.8 ± 0.7* 6.1 ± 0.2* 3.7 ± 0.5* 1.6 ± 0.2* 2.0 ± 0.3* 1.8 ± 1.3*

*denotes signiﬁ cant (P < 0.05) difference between DMSO-treated and untreated cells. Data are expressed as % of total cells mean ± SD) of triplicates

from a representative experiment from two independent studies. The cells were subtyped via ﬂ ow cytometry, based on their forward and side scatter

properties.

doi:10.1371/journal.pone.0152538.t002

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 11 / 24

Fig 3. (A) The effect of DMSO on modulating the activation of cell signaling pathways in response to E . coli- stimulation of human blood monocytes. (B) The

effect of cell signaling inhibitors on IL-6 production form E . coli -challenged human monocytes. Inhibitor concentrations were chosen based on the lowest

levels that markedly inhibited their pathways. * denotes significant inhibition (P< 0.05) of IL-6 production from non-DMSO treated, E. coli challenged

monocytes.

doi:10.1371/journal.pone.0152538.g003

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 12 / 24

studies with these tumor cells demonstrated that DMSO at 1 and 1.5% reduced cell proliferation

(data not shown) and, concomitantly, increased the levels of melanin in these cells, in keeping

with previous reports that DMSO induces, to some extent, B16 differentiation (Fig 4A)[ 31].

However, even though DMSO could induce the partial differentiation of these melanoma

cells, and so might be expected to slow tumor growth in the B16-implanted mice, we found

that topical administration of 70% DMSO (directly to skin at the tumor site) was ineffective in

altering their growth and comparable to topical administration of water alone (Fig 4B).

DMSO Inhibits both M1 and M2 Polarization

To gain some insight into why DMSO was ineffective at slowing down melanoma cancer progres-

sion, we investigated the effect of DMSO on the ability of mФ s to polarize to a healer (M2) or

killer (M1) phenotype and found that DMSO, starting at 0.25% final concentrations, effectively

Fig 4. (A) The effect of DMSO on melanin production in B16/F10 melanoma cells. * denotes significant difference (P< 0.05) in melanin content to non-DMSO

treated cells (B) The effect of topical administration of 70% DMSO on the growth of subcutaneously implanted B16/F10 melanoma cells in C57BL/6 mice

(n = 8) (C ) The effect of DMSO on murine M2 mФ skewing in response to 10 ng/ml IL-4 measured after 72 h of incubation (D ) The effect of DMSO in

modulating iNOS expression and (E) NO production from M1-skewed murine mФ s, measured after 24 h of incubation of cells with 100 ng/mL LPS.

doi:10.1371/journal.pone.0152538.g004

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 13 / 24

suppressed the expression of arginase 1 (Arg-1) in IL-4-treated, bone marrow derived mФ s, sug-

gesting suppression of M2 skewing (Fig 4C ). At the same concentrations, DMSO also reduced the

expression of inducible nitric oxide synthase (iNOS) from LPS-treated mФ s, suggesting it also

suppresses M1 polarization (Fig 4D ). Consistent with this, DMSO, at concentrations as low as

0.08% significantly reduced nitric oxide (NO) production from these cells (Fig 4E). To assess

whether these effects were attributable to cell death, viability studies were carried out and DMSO

had negligible effects on mФ viability at concentrations that inhibited skewing (data not shown).

DMSO thus appears to block the polarization of mФs to either M1 or M2 m Ф phenotypes.

DMSO Reduces Arthritis

Since topical DMSO has been used for many years to reduce both inflammation following exer-

cise or injury and for arthritis, we next examined its efficacy using a mouse model of arthritis.

Specifically, we employed the well-known K/BxN autoimmune arthritis model in which serum

containing auto-antibodies that target glucose-6-phosphate isomerase (GPI) is injected IP.

These auto-antibodies trigger inflammatory responses in the joints of recipients, resembling

the pathogenesis of rheumatoid arthritis [32 – 34 ]. As shown in Fig 5A , immersion of the hind

paws of C57BL/6 mice into 70% DMSO twice daily was effective in reducing the overall swell-

ing of K/BxN-induced arthritis in all hind and fore paws. Interestingly, when the effects of

DMSO on hind and fore paws were evaluated separately, DMSO was found to significantly

reduce the swelling of the front paws only (Fig 5B & 5C), although there was a trend for DMSO

to ameliorate swelling in the hind paws as well. These results correlated with reductions in clin-

ical scores for the DMSO treated mice (Fig 5D, 5E & 5F).

The ability of DMSO to significantly reduce arthritis-induced swelling in the front, but not

in the hind paws corresponded with the efficacy of DMSO to modulate the gene expression of

several pro-inflammatory cytokines that have been implicated in arthritic events (Fig 6 ). For

example, gene expression levels of IL-1β , IL-6, TNFα , CXCL1 and CXCL2 in the hind paws of

the DMSO-treated mice were not significantly different from the hind paws of water-treated

mice while the fore paws of the DMSO-treated mice expressed significantly (P< 0.05) lower lev-

els of pro-inflammatory genes (IL-1β , IL-6, CXCL1 and CXCL2) than the fore paws of mice in

the control group. DMSO levels in the joints and plasma of the mice were also quantified.

Interestingly, even though DMSO was topically administered to only the hind paws, similar

DMSO concentrations were detected in both the fore and hind joints as well as in the plasma of

the mice (Fig 7 ). These results suggest that DMSO diffuses systemically throughout the body.

The systemic effect of DMSO was further shown by the significantly (P< 0.05) lower wbc

numbers, especially monocytes and lymphocytes, in the blood of DMSO-treated mice relative

to water-treated mice (Fig 8 ), regardless of induction of arthritis by K/BxN. A significant

decrease in granulocyte content was also observed, albeit only in DMSO-treated naïve mice,

and not in K/BxN-injected mice. It should also be noted that the effect of DMSO was specific

to wbcs and not to red blood cells or platelets (Fig 8 ). When the joints were evaluated for the

presence of immune cells, it was evident that K/BxN induction promoted recruitment of

immune cells to the joints (Fig 9 , control versus naïve joints). Interestingly, however, DMSO

treatment appeared to reduce the abundance of CD45

cells and PMN cells in the fore but not

the hind joints (Fig 9 ), which corresponds with DMSO being effective in lowering arthritis-

induced swelling in the fore, but not hind paws.

Discussion

We demonstrate herein that DMSO is an anti-inflammatory agent in a whole human blood

assay designed to mimic in vivo responses to infectious agents. Specifically, we found DMSO

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 14 / 24

Fig 5. The effect of DMSO in modulating arthritis-induced swelling in the (A) fore, (B) hind and (C) fore + hind paws of K/BxN serum-injected C57BL/6 mice.

The clinical scores of the (D) fore, (E) hind (F) and fore + hind paws in DMSO and water-treated mice (n = 7–9).

doi:10.1371/journal.pone.0152538.g005

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 15 / 24

potently inhibits the secretion of many E . coli - and HSV-1-induced cytokines/chemokines at a

final concentration of 2%, and some analytes, like G-CSF, IFNγ , IFNα and PGE

are more sen-

sitive, showing substantial reductions at 0.5% DMSO. This anti-inflammatory activity of

DMSO is consistent with previous studies reporting a reduction in pro-inflammatory media-

tors in various model systems [35 – 37 ]. On the other hand, we also found that DMSO promotes

the release of specific pro-inflammatory cytokines from E . coli and HSV-1 stimulated blood

cells. IL-1β and MIP1α levels, for example, are elevated with DMSO exposure. This finding

that DMSO suppresses the expression of some pro-inflammatory cytokines (e.g. IL-8) while

promoting others, specifically IL-1β , has been reported previously by DeForge et al [38 ] using

an LPS-stimulated whole human blood assay. This is, however, somewhat controversial since

Ahn et al [35 ] have reported that DMSO inhibits IL-1β production and the efffects of DMSO

may be highly dependent on the assay and model systems used. We also found, like DeForge

Fig 6. The effect of DMSO on the gene expression of pro-inflammatory cytokines in the joints of KBxN-induced arthritic mice. * denotes significant

(P< 0.05) difference between DMSO and water-treated joints.

denotes a significant (P< 0.05) difference between the fore and hind paws of water-treated

mice.

doi:10.1371/journal.pone.0152538.g006

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 16 / 24

et al [38 ], that DMSO elicits a biphasic response, promoting IL-6 secretion at low and inhibit-

ing it at high concentrations.

Because DMSO is known to compromise cell permeability and cause cell death at high con-

centrations [39,40 ], we investigated whether its anti-inflammatory properties were attributable

to its effects on cell viability. Our results suggest that DMSO, up to a 1% final concentration,

induces little cytotoxicity to monocytes but a considerable decrease in monocytes is observed

at 2%, a mild hemolysis at 5%, and a dramatic decrease in PBMCs at 10%. Thus it appears that

DMSO has only a narrow therapeutic window and it is possible the drop in cytokines/chemo-

kines at 2% DMSO is due to lower viability of the monocytes. However, the effects of DMSO at

concentrations of 0.5% and lower are likely independent of cytotoxicity.

Despite the finding that DMSO can be cytotoxic above 2% in vitro , oral/topical administra-

tion of 70– 100% DMSO has been reported to result in low systemic toxicity in vivo [ 23,41 – 43].

One possible explanation for this is that in vivo , DMSO is rapidly metabolized to DMSO

and

DMS and excreted, primarily through urinary excretion or in expired air, respectively [3].

Because of this we thought it important to look at the immune modulatory effects of these two

metabolites and found in our whole blood assay that DMSO is more effective than DMSO

DMS at reducing E . coli -induced IL-6 secretion. Taken together with earlier in vivo clearance

studies in humans, which show that DMSO

and DMS never reach plasma levels approaching

DMSO levels [23 ], it is likely that DMSO, and not its metabolites, is responsible for its reported

anti-inflammatory properties in vivo.

We next looked at the cell signaling pathways that DMSO might be modulating to affect the

production of cytokines/chemokines. For these studies human monocytes were chosen since

they were found to be the cells primarily responsible for cytokine/chemokine production in

response to an E . coli challenge. From these studies we conclude that E . coli triggers the

Fig 7. DMSO levels in (A) hind and fore joints and (B) plasma of K/BxN mice. * denotes significant (P< 0.05) difference between control (n = 7) and

DMSO-treated mice (n = 9).

doi:10.1371/journal.pone.0152538.g007

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 17 / 24

activation of the PI3K/Akt and the three MAPkinase pathways: p38, ERK1/2 and JNK. To see

which pathways were critical for IL-6 production we employed pathway specific inhibitors and

found that the PI3K, ERK1/2 and p38 signaling pathways are indispensable for the production

of IL-6 while inhibition of JNK signaling is not involved. Related to this, we found that DMSO

inhibits the ERK1/2, p38, PI3K/Akt and JNK pathways signaling pathways. Considering that

DMSO is a solvent capable of disrupting membrane integrity [39 ], it is conceivable that DMSO

is carrying out this inhibition through a non-specific mechanism. However, our findings are

also consistent with the previously reported ability of DMSO to act as a hydroxyl radical scav-

enger (i.e. an antioxidant), since MAPkinase and PI3K/Akt signaling pathways contain redox

sensitive sites that can be stress-activated in response to inflammatory stimuli [44 , 45].

DMSO has been touted as efficacious in the treatment of cancer, in part via its ability to

induce the differentiation of some cancer cell lines [46,47 ]. The recent shut down of a DMSO

clinic by the FDA in 2013 after a suspicious patient death only further confirms the need for

more in vivo work to demonstrate the safety and efficacy of DMSO for cancer treatment [48].

Fig 8. The effect of DMSO in naï ve and K/BxN-injected mice on A) blood cell composition and B) white blood cell subtypes. * denotes significant

(P< 0.05) difference between water and DMSO-treated mice in either na ï ve, or K/BxN-injected mice (n = 5).

doi:10.1371/journal.pone.0152538.g008

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 18 / 24

Before embarking on in vivo studies in mice we first compared plasma DMSO levels follow-

ing IP, oral and topical administration at doses that, according to the literature, were the high-

est without being toxic [49 ]. As shown in Table 3 , highest DMSO levels were achieved via IP

administration, with topical giving the second highest. However, given that IP injections would

be difficult for people to self-administer and may not give as high local skin concentrations as

topical treatments we opted to pursue in vivo studies using topical DMSO.

We chose the B16 mouse melanoma cell line for our in vivo evaluation of DMSO since this

cell line has been shown to differentiate in response to DMSO [31 ] and in vivo tumors can be

Fig 9. The effect of DMSO in PMN and CD45

cells in the wrist and ankle joints of KBxN-injected mice. Naï ve mice serve as control mice not injected

with KBxN serum (n = 3–4).

doi:10.1371/journal.pone.0152538.g009

Table 3. Plasma DMSO levels in mice following different routes of administration.

Intraperitoneal

Oral

Topical

Plasma DMSO (%) 0.32– 0.76 0.004– 0.04 0.06–0.25

30 min after IP injection of 4g/kg of DMSO (n = 8)

Oral consumption of 2% DMSO in drinking water (n = 10)

Topical administration of 70% DMSO for 30 sec to hind paws 2 (n = 10) and 4 times (n = 4)

doi:10.1371/journal.pone.0152538.t003

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 19 / 24

treated topically. However, even though we indeed found that DMSO promotes the differentia-

tion of these cells, as evidenced by increased melanin production and reduced proliferation,

our in vivo studies suggest that DMSO, administered at a 70% concentration by topical expo-

sure four times a day to the shaved back of melanoma-implanted mice does not alter the

growth rate of tumors when compared to mice treated with water only. An analysis of IL-6 lev-

els in the plasma and the tumors of DMSO- and water-treated mice also revealed no difference,

suggesting that DMSO did not alter the systemic inflammatory state of these mice, perhaps

because therapeutic levels of DMSO were not reached with this protocol. On the other hand, it

is possible that tumor growth was not reduced because some cytokines, like the more DMSO

sensitive G-CSF and IFNγ , were inhibited and this reduced the ability of the immune system to

restrain tumor growth. Related to this, we looked at the effect of DMSO on macrophage polari-

zation and found that it reduced both M1- and M2- skewing, starting at 0.25% concentration.

It is thus possible that DMSO was ineffective in vivo because it dampened down the anti-tumor

M1 phenotype of the infiltrating macrophages. This is in contrast to a recent study by Deng

et al [50 ], who IP injected DMSO to 4T1-tumor bearing mice and found this suppressed tumor

growth by polarizing their tumor associated macrophage from an M2- to an M1-phenotype. It

remains to be determined if the difference in our results is attributable to the mode of adminis-

tration or the tumor cells utilized.

DMSO is currently widely used in inflammatory conditions such as rheumatoid arthritis and

clinical trials are underway, although it is difficult to derive any conclusions from these trials

since the garlicky odor generated from DMSO 's metabolite, DMS, prevents a truly double blind

study [16,51 ]. In our studies, arthritis was induced by IP injection of K/BxN serum to C57BL/6

mice. Topical exposure of the hind paws to 70% DMSO, administered twice daily, showed a

trend towards a reduction in the swelling of the hind paws and a more marked, statistically sig-

nificant reduction in the swelling of the front paws. This was associated with a lower gene

expression of a number of pro-inflammatory cytokines and chemokines, compared to water-

treated mice. This is consistent with what we observed in the blood assay where DMSO reduced

the expression of pro-inflammatory cytokines, with the exception of IL-1 β. However, there are

many possible explanations for the difference seen between the slightly elevated IL-1β mature

protein levels in the 7 h whole human blood assay after DMSO treatment and the lower in vivo

IL-1β mRNA levels found in the front paw joints after 7 days of DMSO treatment, the most

likely being that DMSO acts to reduce neutrophil recruitment to the synovial joints, which leads

to a reduced presence of pro-inflammatory cytokines such as IL-1β . Neutrophils are thought to

play an essential role in the initiation and progression of arthritis in this K/BxN model system

and were shown to be the main type of immune cell present in the synovial joint during inflam-

mation [52 – 54 ]. The finding that DMSO lowers wbc numbers in blood and reduces mRNA lev-

els of IL-6, CXCL2, TNFα , IL-1β and CXCL1 in the fore paws of DMSO treated mice, coupled

with the observation that fewer CD45

cells (total leukocytes) and PMN are observed in the fore

joints, but not the hind joints of DMSO-treated mice, supports our hypothesis that topical

administration of DMSO systemically suppresses wbc levels, perhaps via DMSO' s effects on

G-CSF levels, that in turn reduce recruitment of neutrophils to the joints and mitigates arthritic

events from occurring. To test this hypothesis we exposed mouse bone marrow-derived mФ sto

various DMSO concentrations for 3 days (to mimic in vivo exposure times) and found that

while these DMSO concentrations did not reduce the viability of these cells (S1 Fig ), concentra-

tions as low as 0.3% (a concentration comparable to that found in mouse plasma after topical

administration of DMSO) significantly inhibited LPS-induced G-CSF production (S2 Fig ).

Importantly, our finding that fewer CD45+ cells are observed in the fore joints of DMSO-treated

mice is consistent with a previous report showing that DMSO inhibits the infiltration of granu-

locytes and monocytes into infected pleural spaces in rabbits [55 ]. The lower efficacy in the hind

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 20 / 24

joints, despite a similar DMSO concentration in the hind and fore paws, as well as in the plasma,

might be explained by the confounding skin irritation that is known to occur with topical appli-

cation of 70% and higher concentrations of DMSO [56].

To date, studies into the efficacy of DMSO in animal models of rheumatoid arthritis have

produced conflicting results. Colucci et al [57 ], for example, showed that oral administration of

DMSO to mice was effective in reducing zymosan-induced edema in the mouse paw, while local

administration of DMSO enhanced paw swelling instead. On the other hand, Görög and Kovács

(1968) demonstrated in adjuvant arthritic rats, that topical application of DMSO produced a

more pronounced anti-inflammatory effect than when given orally [58 ]. Confounding factors in

these studies that could contribute to the discrepancies observed are the dose and route of

administration of DMSO as well as the animal models used to recapitulate arthritic events. Top-

ical administration of DMSO in inflammatory agent(s)-induced arthritic rats for example, was

thought to increase the penetration of the inflammatory agents into tissues, resulting in a lack of

efficacy or an exacerbation of paw edema [59 ]. However, the etiology of inflammation in the K/

BxN mice does not rely on the introduction of exogenous inflammatory agents, but on the rec-

ognition of endogenous auto-antigen that triggers the activation of the innate immune system,

which more closely resembles the pathogenesis of rheumatoid arthritis in humans.

In conclusion, DMSO is an anti-inflammatory agent that demonstrates efficacy in whole

human blood by inhibiting the ERK1/2, p38, JNK and PI3K/Akt signaling pathways in human

monocytes during inflammation. This is associated with a reduction in the production of

inflammatory mediators such as G-CSF at low DMSO concentrations. This in turn likely leads

to a systemic suppression of wbc levels that contributes to DMSO' s efficacy in reducing

arthritic events in the K/BxN mouse model and its inability to slow B16 melanoma growth. We

therefore conclude that the use of DMSO as an anti-inflammatory agent in conditions such as

rheumatoid arthritis may have some merit but cannot support its use as an anti-cancer agent.

Supporting Information

S1 Fig. DMSO does not affect the viability of bone marrow-derived mФ s cultured in

M-CSF and stimulated with LPS (10 ng/mL) for 3 days as determined using the MTT assay.

Results are expressed as a % of non-DMSO-treated cell viability (n = 3).

(TIF)

S2 Fig. DMSO reduces G-CSF production from bone marrow-derived mФ s cultured in

M-CSF and stimulated with LPS at 10 ng/mL for 3 days. G-CSF levels were determined by

ELISA (R&D Systems, Minneapolis, MN) according to the manufacturer' s instructions. 

denotes significant (P < 0.05) difference relative to non-DMSO-treated cells (n = 3).

(TIF)

Acknowledgments

We would like to thank Christine Kelly for formatting and submitting the manuscript. This

work was supported by the Lotte & John Hecht Memorial Foundation, with core support from

the BC Cancer Foundation and the BC Cancer Agency.

Author Contributions

Conceived and designed the experiments: IE HN MRH IS GK. Performed the experiments: IE

HN VL EH RC JC MRH LL HHA. Analyzed the data: IE VL RC JC MRH HHA. Contributed

reagents/materials/analysis tools: WJ ESG KMM GK. Wrote the paper: IE JC MRH HHA

KMM IS GK.

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 21 / 24

References

1. Santos NC, Figueira-Coelho J, Martins-Silva J, Saldanha C. Multidisciplinary utilization of dimethyl sulf-

oxide: pharmacological, cellular, and molecular aspects. Biochemical Pharmacology. 2003; 65: 1035–

1041. PMID: 12663039 doi: 10.1016/S0006-2952(03)00002-9

2. Capriotti K, Capriotti JA. Dimethyl sulfoxide: History, chemistry and clinical utility in dermatology. The

Journal of Clinical and Aesthetic Dermatology. 2012; 5: 24– 26. PMID: 23050031

3. Jimenez RAH, Willkens RF. Dimethyl Sulfoxide: a perspective of its use in rheumatoid disease. Journal

of Laboratory and Clinical Medicine. 1982; 100: 489– 500. PMID: 6750016

4. Pegg D. Principles of Cryopreservation. In: Day J, Stacey G, editors. Cryopreservation and Freeze-Dry-

ing Protocols. Humana Press; 2007. pp. 39–57.

5. Jacob SW, Bischel M, Herschler RJ. Dimethyl Sulfoxide (DMSO): A New Concept in Pharmacotherapy.

Current Therapeutic Research, Clinical and Experimental. 1964; 6: 134– 135. PMID: 14135298

6. Steinberg A. The employment of dimethyl sulfoxide as an antiinflammatory agent and steroid-trans-

porter in diversified clinical diseases. Annals of the New York Academy of Sciences. 1967; 141: 532–

550. PMID: 5232266 doi: 10.1111/j.1749-6632.1967.tb34922.x

7. Rosenbaum EE, Herschler RJ, Jacob SW. Dimethyl sulfoxide in musculoskeletal disorders. Journal of

the American Medical Association. 1965; 192: 309– 313. PMID: 14271981 doi: 10.1001/jama.1965.

03080170037009

8. Rosenbaum EE, Jacob SW. Dimethyl Sulfoxide (DMSO) in Musculoskeletal Injuries and Inflammations.

II. Dimethyl Sulfoxide in Rheumatoid Arthritis, Degenerative Arthritis and Gouty Arthritis. Northwest

Medicine. 1964; 63: 227– 229. PMID: 14137825

9. Ehrlich GE, Joseph R. Dimethyl Sulfoxide in Scleroderma. Pennsylvannia Medicine. 1965; 68: 51–53.

PMID: 5856390

10. DMSO ban: Was it handled properly? Journal of the American Medical Association. 1966; 195: A33–

A34. doi: 10.1001/jama.1966.03100010017005

11. Dimethyl sulfoxide: Controversy and current status— 1981. Journal of the American Medical Associa-

tion. 1982; 248: 1369– 1371. doi: 10.1001/jama.1982.03330110061032

12. Myrer JW, Heckmann R, Francis RS. Topically applied dimethyl sulfoxide: Its effects on inflammation

and healing of a contusion. The American Journal of Sports Medicine. 1986; 14: 165– 169. PMID:

3717490

13. U.S. Food and Drug Administration. 187 Fake Cancer "Cures" Consumers Should Avoid. 2009. Avail-

able: http://www.fda.gov/Drugs/GuidanceComplianceRegulatoryInformation/

EnforcementActivitiesbyFDA/ucm171057.htm

14. WebMD. DMSO (DIMETHYLSULFOXIDE). 2014. Available: http://www.webmd.com/vitamins-

supplements/ingredientmono-874-dmso%20dimethylsulfoxide.aspx?activeingredientid=

874&activeingredientname=dmso%20dimethylsulfoxide

15. Camelot Cancer Care Inc. 2015. Available: https://camelotcancercare.is/faqs/

16. Trice JM, Pinals RS. Dimethyl sulfoxide: A review of its use in the rheumatic disorders. Seminars in

Arthritis and Rheumatism. 1985; 15: 45– 60. PMID: 3898376

17. Muir M. DMSO. Alternative and Complementary Therapies. 1996; 2: 230– 235. doi: 10.1089/act.1996.

2.230

18. Hosoi J, Abe E, Suda T, Kuroki T. Regulation of melanin synthesis of B16 mouse melanoma Cells by

1α , 25-Dihydroxyvitamin D3 and Retinoic Acid. Cancer Research. 1985; 45: 1474 – 1478. PMID:

2983883

19. Overwijk WW, Restifo NP. B16 as a mouse model for human melanoma. Current Protocols in Immunol-

ogy. 2001; Chapter 20:Unit 20.1 PMID: 18432774 doi: 10.1002/0471142735.im2001s39

20. Weisser S, McLarren K, Kuroda E, Sly L. Generation and Characterization of Murine Alternatively Acti-

vated Macrophages. In: Helgason CD, Miller CL, editors. Basic Cell Culture Protocols. Humana Press;

2013. pp. 225– 239. PMID: 23179835 doi: 10.1007/978-1-62703-128-8_14

21. Nigrovic P, Shin K.Evaluation of synovial mast cell functions in autoimmune arthritis. In: Hughes MR,

McNagny KM, editors. Mast Cells. Springer New York; 2015. pp. 423– 442. PMID: 25388266 doi: 10.

1007/978-1-4939-1568-2_26

22. Blanchet MR, Gold M, Maltby S, Bennett J, Petri B, Kubes P, et al. Loss of CD34 leads to exacerbated

autoimmune arthritis through increased vascular permeability. The Journal of Immunology. 2010; 184:

1292– 1299. PMID: 20038636 doi: 10.4049/jimmunol.0900808

23. Hucker HB, Miller JK, Hochberg A, Brobyn RD, Riordan FH, Calesnick B. Studies on the absorption,

excretion and metabolism of dimethylsulfoxide (DMSO) in man. Journal of Pharmacology and Experi-

mental Therapeutics. 1967; 155: 309– 317. PMID: 6025521

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 22 / 24

24. Becker K, Schroecksnadel S, Gostner J, Zaknun C, Schennach H, Überall F, et al. Comparison of in

vitro tests for antioxidant and immunomodulatory capacities of compounds. Phytomedicine. 2014; 21:

164– 171. PMID: 24041614 doi: 10.1016/j.phymed.2013.08.008

25. Stø levik SB, Nygaard UC, Namork E, Granum B, Pellerud A, van Leeuwen DM, et al. In vitro cytokine

release from human peripheral blood mononuclear cells in the assessment of the immunotoxic potential

of chemicals. Toxicology in Vitro. 2011; 25: 555– 562. PMID: 21144890 doi: 10.1016/j.tiv.2010.11.021

26. Martinon F, Burns K, Tschopp J. The Inflammasome: A molecular platform triggering activation of

inflammatory caspases and processing of proIL-β . Molecular Cell. 2002; 10: 417– 426. PMID:

12191486 doi: 10.1016/S1097-2765(02)00599-3

27. Zlotnik A, Yoshie O. Chemokines: A New Classification System and Their Role in Immunity. Immunity.

2000; 12: 121– 127. PMID: 10714678 doi: 10.1016/S1074-7613(00)80165-X

28. Perry AK, Chen G, Zheng D, Tang H, Cheng G. The host type I interferon response to viral and bacterial

infections. Cell Research. 2005; 15: 407– 422. PMID: 15987599

29. Reed KW, Yalkowsky SH. Lysis of human red blood cells in the presence of various cosolvents. PDA

Journal of Pharmaceutical Science and Technology. 1985; 39: 64– 69. PMID: 3559834

30. Guha M, Mackman N. LPS induction of gene expression in human monocytes. Cellular Signalling.

2001; 13: 85– 94. PMID: 11257452 doi: 10.1016/S0898-6568(00)00149-2

31. Nordenberg J, Wasserman L, Beery E, Aloni D, Malik H, Stenzel KH, et al. Growth inhibition of murine

melanoma by butyric acid and dimethylsulfoxide. Experimental Cell Research. 1986; 162: 77–85.

PMID: 3079593

32. Monach PA, Mathis D, Benoist C. The K/BxN arthritis model. In: Current Protocols in Immunology.

John Wiley & Sons, Inc; 2001. PMID: 18491295 doi: 10.1002/0471142735.im1522s81

33. Monach P, Hattori K, Huang H, Hyatt E, Morse J, Nguyen L, et al. The K/BxN mouse model of inflamma-

tory arthritis: Theory and practice. 2007; 136: 269– 282. PMID: 17983155

34. Kyburz D, Corr M. The KRN mouse model of inflammatory arthritis. Springer Seminars in Immunopa-

thology. 2003; 25: 79– 90. PMID: 12904893 doi: 10.1007/s00281-003-0131-5

35. Ahn H, Kim J, Jeung EB, Lee GS. Dimethyl sulfoxide inhibits NLRP3 inflammasome activation. Immu-

nobiology. 2014; 219: 315– 322. PMID: 24380723 doi: 10.1016/j.imbio.2013.11.003

36. Hollebeeck S, Raas T, Piront N, Schneider YJ, Toussaint O, Larondelle Y, et al.Dimethyl sulfoxide

(DMSO) attenuates the inflammatory response in the in vitro intestinal Caco-2 cell model. Toxicology

Letters. 2011; 206: 268– 275. PMID: 21878375 doi: 10.1016/j.toxlet.2011.08.010

37. Kloesch B, Liszt M, Broell J, Steiner G. Dimethyl sulphoxide and dimethyl sulphone are potent inhibitors

of IL-6 and IL-8 expression in the human chondrocyte cell line C-28/I2. Life Sciences. 2011; 89: 473–

478. PMID: 21821055 doi: 10.1016/j.lfs.2011.07.015

38. DeForge LE, Preston AM, Takeuchi E, Kenney J, Boxer LA, Remick DG. Regulation of interleukin 8

gene expression by oxidant stress. The Journal of Biological Chemistry. 1993; 268: 25568–25576.

PMID: 8244994

39. Gurtovenko AA, Anwar J. Modulating the structure and properties of cell membranes: The molecular

mechanism of action of dimethyl sulfoxide. The Journal of Physical Chemistry B. 2008; 111: 10453–

10460. PMID: 17661513 doi: 10.1021/jp073113e

40. Da Violante G, Zerrouk N, Richard I, Provot G, Chaumeil JC, Arnaud P. Evaluation of theCytotoxicity

Effect of Dimethyl Sulfoxide (DMSO) on Caco2/TC7 Colon Tumor Cell Cultures. Biological and Phar-

maceutical Bulletin. 2002; 25: 1600– 1603. PMID: 12499647 doi: 10.1248/bpb.25.1600

41. Teigland MB, Saurino VR. Clinical Evaluation of Dimethyl Sulfoxide in Equine Applications. Annals of

the New York Academy of Sciences. 1967; 141: 471– 477. PMID: 4167019

42. Layman DL, Jacob SW. The absorption, metabolism and excretion of dimethyl sulfoxide by Rhesus

monkeys. Life Sciences. 1985; 37: 2431– 2437. PMID: 4079657

43. Kolb KH, Jaenicke G, Kramer M, Schulze PE. Absorption, distribution, and elimination of labeled

dimethyl sulfoxide in man and animals. Annals of the New York Academy of Sciences. 1967; 141: 85–

95. PMID: 5232278

44. Allen RG, Tresini M. Oxidative stress and gene regulation. Free Radical Biology and Medicine. 2000;

28: 463– 499. PMID: 10699758 doi: 10.1016/S0891-5849(99)00242-7

45. Ngkelo A, Meja K, Yeadon M, Adcock I, Kirkham P. LPS induced inflammatory responses in human

peripheral blood mononuclear cells is mediated through NOX4 and Gialpha dependent PI-3kinase sig-

nalling. Journal of Inflammation. 2012; 9: 1. PMID: 22239975 doi: 10.1186/1476-9255-9-1

46. Siracký J, Blasko M, Borovanský J. Stimulation of differentiation in human melanoma cells by dimethyl

sulphoxide (DMSO). Neoplasma. 1985; 32: 635– 638. PMID: 4088387

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 23 / 24

47. Collins SJ, Ruscetti FW, Gallagher RE, Gallo RC. Terminal differentiation of human promyelocytic leu-

kemia cells induced by dimethyl sulfoxide and other polar compounds. Proceedings of the National

Academy of Sciences. 1978; 75: 2458– 2462. PMID: 276884

48. Cox Media Group. Camelot Cancer Care shut down following suspicious death. 2014. Available: http://

www.fox23.com/news/news/local/camelot-cancer-care-shut-down-following-suspicious/nh236/

#sthash.Pe4sJ2fm.dpuf.

49. Aita K, Irie H, Tanuma Y, Toida S, Okuma Y, Mori S, et al.Apoptosis in murine lymphoid organs follow-

ing intraperitoneal administration of dimethyl sulfoxide (DMSO). Experimental and Molecular Pathol-

ogy. 2005; 79: 265– 271. PMID: 16154562 doi: 10.1016/j.yexmp.2005.07.001

50. Deng R, Wang SM, Yin T, Ye TH, Shen GB, Li L, et al. Dimethyl sulfoxide suppresses mouse 4T1

breast cancer growth by modulating tumor-associated macrophage differentiation. Journal of Breast

Cancer. 2014; 17: 25– 32. PMID: 24744794 doi: 10.4048/jbc.2014.17.1.25

51. Matsumoto J. Clinical trials of dimethyl sulfoxide in rheumatoid arthritis patients in Japan. Annals of the

New York Academy of Sciences. 1967; 141: 560– 568. PMID: 5342265

52. Wipke BT, Allen PM.Essential role of neutrophils in the initiation and progression of a murine model of

rheumatoid arthritis. The Journal of Immunology. 2001; 167: 1601– 1608. PMID: 11466382

53. Ditzel HJ.The K/BxN mouse: a model of human inflammatory arthritis. Trends in Molecular Medicine.

2004; 10: 40– 45. PMID: 14720585 doi: 10.1016/j.molmed.2003.11.004

54. Wright HL, Moots RJ, Bucknall RC, Edwards SW. Neutrophil function in inflammation and inflammatory

diseases. Rheumatology. 2010; 49: 1618– 1631. PMID: 20338884 doi: 10.1093/rheumatology/keq045

55. Antony VB, Sahn SA, Repine JE. Dimethyl sulfoxide inhibits phagocyte influx into infected pleural

spaces and phagocyte locomotion in vitro. Inflammation. 1983; 7: 377– 385. PMID: 6654475

56. Sulzberger MB, Cortese TA, Fishman L, Wiley HS, Peyakovich PS. Some effects of DMSO on human

skin in vivo. Annals of the New York Academy of Sciences. 1967; 141: 437– 450. PMID: 5232255 doi:

10.1111/j.1749-6632.1967.tb34908.x

57. Colucci M, Maione F, Bonito MC, Piscopo A, Di Giannuario A, Pieretti S. New insights of dimethyl sulph-

oxide effects (DMSO) on experimental in vivo models of nociception and inflammation. Pharmacologi-

cal Research. 2008; 57: 419– 425. PMID: 18508278 doi: 10.1016/j.phrs.2008.04.004

58. Görög P, Kovács IB. Effect of dimethyl sulfoxide (DMSO) on various experimental inflammations. Cur-

rent Therapeutic Research, Clinical and Experimental. 1968; 10: 486– 493. PMID: 4971653

59. Preziosi P, Scapagnini U. Action of dimethylsulfoxide on acute inflammatory reactions. Current Thera-

peutic Research, Clinical and Experimental. 1966; 8: 261– 264. PMID: 4956389

DMSO Represses Human Cytokine/Chemokine Production

PLOS ONE | DOI:10.1371/journal.pone.0152538 March 31, 2016 24 / 24

... The rather high biocompatibility of dimethyl sulfoxide (DMSO) has allowed it to find application in, for example, transdermal delivery of pharmaceutics [211], as a polymerase chain inhibitor [212] and as a cryoprotectant [213]. However, it is also employed as a drug in its own right, for example it is the only FDA-approved treatment of interstitial cystitis [214], and is commonly used in veterinary medicine, e.g. to treat inflammatory arthritis [215]. Indeed, at less than 10 vol% in vitro [216], DMSO demonstrates a significant anti-inflammatory character, inhibiting lymphocyte activation [216], as well as M1 or M2 macrophage polarization, and nullifying rheumatoid arthritis in mice (70 vol% topical administration) [214]. ...

... However, it is also employed as a drug in its own right, for example it is the only FDA-approved treatment of interstitial cystitis [214], and is commonly used in veterinary medicine, e.g. to treat inflammatory arthritis [215]. Indeed, at less than 10 vol% in vitro [216], DMSO demonstrates a significant anti-inflammatory character, inhibiting lymphocyte activation [216], as well as M1 or M2 macrophage polarization, and nullifying rheumatoid arthritis in mice (70 vol% topical administration) [214]. It is believed that these properties derive from DMSO's antioxidant (ROS sequestering) activity [217] and its ability to reduce prostaglandin E2 [215], although it is plausible the latter is a downstream event of the former. ...

The introduction of low-oxidation-state sulfur atoms is a popular strategy to provide macromolecules with responsivity to oxidizing conditions, which in turn may confer them specific functionality (e.g. bioactivity or improved targeting). Indeed, reactive oxygen species (i.e. biologically relevant oxidants, ROS) at sufficiently low concentrations are essential for the healthy functioning of biological systems, but their overproduction is associated to a broad range of pathologies; chiefly, but by no means uniquely, those of an inflammatory character. Oxidation-sensitive materials therefore offer the possibility to perform two contemporaneous actions, i.e. direct ROS scavenging – with immediate anti-inflammatory effects - and ROS-triggered actions such as the release of appropriate drugs. In this review, we aim to acquaint the reader with the different strategies for the introduction of low-oxidation-state sulfur groups (thioethers, bis(alkylthio)alkenes, sulfoxides, thioketals, oligosulfides) in polymer structures, their responsiveness and their biomedical applications.

... They have frequently been used to improve the solubility of compounds that are difficult to solubilize in water or aqueous solvents (2)(3)(4). Even though seemingly alluring for solubility purposes, these agents individually have been shown to possess antimicrobial (4-10) (https://www.dmso.org/articles/information/herschler.htm) and anti-inflammatory properties (6,11,12). More specifically, DMSO has been suggested to exert its antimicrobial effects as a result of bacterial membrane penetration and perturbation (13,14), while PEGs are thought to lead to bacterial cell clumps and microbial morphological alterations that eventually lead to bacterial killing (7). ...

Dimethyl sulfoxide (DMSO) and polyethylene glycols (PEGs) are frequently used as potent excipients in pharmaceutical formulations. However, these agents also have an interesting antimicrobial and anti-inflammatory profile that could interfere with the efficacy testing of anti-infective compounds when the latter are solubilized in DMSO or PEGs. Here, we demonstrate the antimicrobial and anti-inflammatory effects of DMSO-PEG400 in a murine Pseudomonas aeruginosa infection model, aiming to draw attention to the appropriate selection of solvents for difficult-to-solubilize anti-infectives. IMPORTANCE Our study demonstrates the antimicrobial and anti-inflammatory effects of the combination of DMSO and PEG400 against Pseudomonas aeruginosa in vitro and in vivo in a murine infection model of heightened intestinal permeability. The aim of this study is to draw attention to the appropriate selection of solvents for difficult-to-solubilize anti-infective compounds, to avoid interference with the assay or system tested. This is an extremely important consideration, since potential antimicrobial and anti-inflammatory effects of the solvent vehicle are detrimental to research studies on the efficacy of new anti-infective agents, given that the vehicle effect can mask the effect of the tested compounds. Our results can therefore be of great value to the scientific community, as they can guide researchers in the future to avoid this significant pitfall that can cost substantial amounts of money and valuable time during investigations of the effects of novel, difficult-to-solubilize antimicrobial compounds.

... In a recent study, Elisia et al. 67 indicated that treatment with 2% DMSO repressed the production of inflammatory cytokines, such as TNF-a, IFN-a, and IFN-g, elicited by Escherichia coli infection or by herpes simplex virus-1 (HSV-1) infection in human whole blood cells. The same authors also reported that immersion of the hind paws of the C57BL/6 mice in 70% DMSO, twice daily, effectively reduced the swelling of arthritis in the K/BxN mice model. ...

Dimethyl sulfoxide (DMSO) is an amphipathic molecule widely used as a solvent for water-insoluble substances, cryopreserving, and cell-biological therapies. It has known properties as an inducer of cellular differentiation, a free radical scavenger, and a radioprotectant. In addition, DMSO is used for its various therapeutic and pharmaceutical properties, such as anti-inflammatory, local and systemic analgesic, antibacterial, antifungal, antiviral, and membrane penetration enhancement agents. DMSO treatment can be given orally, intravenously, or topically for a wide range of indications. The administration of DMSO exhibits favorable outcomes in human eye diseases with low to none observed ocular or systemic ocular toxicity. Nevertheless, DMSO is an essential and nonpatentable potential therapeutic agent that remains underexplored and ignored by pharmaceutical developers and ophthalmologists. This current review takes data from experimental and clinical studies that have been published to substantiate the potential therapeutic efficacy of DMSO and stimulate the research of its application in clinical ophthalmology. Given that DMSO is inexpensive, safe, and easily formulated into therapeutic medicinal products and conventional ophthalmological drugs, this compound should be further explored and studied in the treatment of a variety of acute and chronic ocular disorders.

... Indeed, this compound was previously shown to exhibit its own therapeutic activity in the eye by facilitating corneal healing and exhibiting anti-inflammatory effects [57][58][59][60]. The mechanisms underlying these benefits may be related to the downregulation of PGE2 [61]. A similar effect of DMSO was observed in our model (see Figure 6). ...

Dry eye syndrome (DES) is characterized by decreased tear production and stability, leading to desiccating stress, inflammation and corneal damage. DES treatment may involve targeting the contributing inflammatory pathways mediated by polyunsaturated fatty acids and their derivatives, oxylipins. Here, using an animal model of general anesthesia-induced DES, we addressed these pathways by characterizing inflammatory changes in tear lipidome, in correlation with pathophysiological and biochemical signs of the disease. The decline in tear production was associated with the infiltration of inflammatory cells in the corneal stroma, which manifested one to three days after anesthesia, accompanied by changes in tear antioxidants and cytokines, resulting in persistent damage to the corneal epithelium. The inflammatory response manifested in the tear fluid as a short-term increase in linoleic and alpha-linolenic acid-derived oxylipins, followed by elevation in arachidonic acid and its derivatives, leukotriene B4 (5-lipoxigenase product), 12-hydroxyeicosatetraenoic acid (12-lipoxigeanse product) and prostaglandins, D2, E2 and F2α (cyclooxygenase products) that was observed for up to 7 days. Given these data, DES was treated by a novel ophthalmic formulation containing a dimethyl sulfoxide-based solution of zileuton, an inhibitor of 5-lipoxigenase and arachidonic acid release. The therapy markedly improved the corneal state in DES by attenuating cytokine- and oxylipin-mediated inflammatory responses, without affecting tear production rates. Interestingly, the high efficacy of the proposed therapy resulted from the synergetic action of its components, namely, the general healing activity of dimethyl sulfoxide, suppressing prostaglandins and the more specific effect of zileuton, downregulating leukotriene B4 (inhibition of T-cell recruitment), as well as upregulating docosahexaenoic acid (activation of resolution pathways).

Dimethylsufoxide (DMSO) being universally used as a cryoprotectant in clinical adoptive cell-therapy settings to treat hematological malignancies and solid tumors is a growing concern, largely due to its broad toxicities. Its use has been associated with significant clinical side effects—cardiovascular, neurological, gastrointestinal, and allergic—in patients receiving infusions of cell-therapy products. DMSO has also been associated with altered expression of natural killer (NK) and T-cell markers and their in vivo function, not to mention difficulties in scaling up DMSO-based cryoprotectants, which introduce manufacturing challenges for autologous and allogeneic cellular therapies, including chimeric antigen receptor (CAR)-T and CAR-NK cell therapies. Interest in developing alternatives to DMSO has resulted in the evaluation of a variety of sugars, proteins, polymers, amino acids, and other small molecules and osmolytes as well as modalities to efficiently enable cellular uptake of these cryoprotectants. However, the DMSO-free cryopreservation of NK and T cells remains difficult. They represent heterogeneous cell populations that are sensitive to freezing and thawing. As a result, clinical use of cryopreserved cell-therapy products has not moved past the use of DMSO. Here, we present the state of the art in the development and use of cryopreservation options that do not contain DMSO toward clinical solutions to enable the global deployment of safer adoptively transferred cell-based therapies.

Darcy R Denner
Maria LD Udan-Johns
Michael R Nichols

Background: Matrix metalloproteinases (MMPs), including MMP-9, are an integral part of the immune response and are upregulated in response to a variety of stimuli. New details continue to emerge concerning the mechanistic and regulatory pathways that mediate MMP-9 secretion. There is significant evidence for regulation of inflammation by dimethyl sulfoxide (DMSO) and 3',5'-cyclic adenosine monophosphate (cAMP), thus investigation of how these two molecules may regulate both MMP-9 and tumor necrosis factor α (TNFα) secretion by human monocytes was of high interest. The hypothesis tested in this study was that DMSO and cAMP regulate MMP-9 and TNFα secretion by distinct mechanisms. Aim: To investigate the regulation of lipopolysaccharide (LPS)-stimulated MMP-9 and tumor necrosis factor α secretion in THP-1 human monocytes by dimethyl sulfoxide and cAMP. Methods: The paper describes a basic research study using THP-1 human monocyte cells. All experiments were conducted at the University of Missouri-St. Louis in the Department of Chemistry and Biochemistry. Human monocyte cells were grown, cultured, and prepared for experiments in the University of Missouri-St. Louis Cell Culture Facility as per accepted guidelines. Cells were treated with LPS for selected exposure times and the conditioned medium was collected for analysis of MMP-9 and TNFα production. Inhibitors including DMSO, cAMP regulators, and anti-TNFα antibody were added to the cells prior to LPS treatment. MMP-9 secretion was analyzed by gel electrophoresis/western blot and quantitated by ImageJ software. TNFα secretion was analyzed by enzyme-linked immuno sorbent assay. All data is presented as the average and standard error for at least 3 trials. Statistical analysis was done using a two-tailed paired Student t-test. P values less than 0.05 were considered significant and designated as such in the Figures. LPS and cAMP regulators were from Sigma-Aldrich, MMP-9 standard and antibody and TNFα antibodies were from R&D Systems, and amyloid-β peptide was from rPeptide. Results: In our investigation of MMP-9 secretion from THP-1 human monocytes, we made the following findings. Inclusion of DMSO in the cell treatment inhibited LPS-induced MMP-9, but not TNFα, secretion. Inclusion of DMSO in the cell treatment at different concentrations inhibited LPS-induced MMP-9 secretion in a dose-dependent fashion. A cell-permeable cAMP analog, dibutyryl cAMP, inhibited both LPS-induced MMP-9 and TNFα secretion. Pretreatment of the cells with the adenylyl cyclase activator forskolin inhibited LPS-induced MMP-9 and TNFα secretion. Pretreatment of the cells with the general cAMP phosphodiesterase inhibitor IBMX reduced LPS-induced MMP-9 and TNFα in a dose-dependent fashion. Pre-treatment of monocytes with an anti-TNFα antibody blocked LPS-induced MMP-9 and TNFα secretion. Amyloid-β peptide induced MMP-9 secretion, which occurred much later than TNFα secretion. The latter two findings strongly suggested an upstream role for TNFα in mediating LPS-stimulate MMP-9 secretion. Conclusion: The cumulative data indicated that MMP-9 secretion was a distinct process from TNFα secretion and occurred downstream. First, DMSO inhibited MMP-9, but not TNFα, suggesting that the MMP-9 secretion process was selectively altered. Second, cAMP inhibited both MMP-9 and TNFα with a similar potency, but at different monocyte cell exposure time points. The pattern of cAMP inhibition for these two molecules suggested that MMP-9 secretion lies downstream of TNFα and that TNFα may a key component of the pathway leading to MMP-9 secretion. This temporal relationship fit a model whereby early TNFα secretion directly led to later MMP-9 secretion. Lastly, antibody-blocking of TNFα diminished MMP-9 secretion, suggesting a direct link between TNFα secretion and MMP-9 secretion.

Nao Nishikoba
Kotaro Kumagai
Shuji Kanmura
Akio Ido

Backgrounds and Aims: Hepatocyte Growth Factor (HGF)-MET signaling is known to promote biological functions such as cell survival, cell motility, and cell proliferation. However, it is unknown if HGF-MET alters the macrophage phenotype. In this study, we aimed to study the effects of HGF-MET signaling on the M1 macrophage phenotype. Methods and Materials: Bone marrow-derived macrophages (BMDMs) isolated from mice were either polarized to an M1 phenotype by IFN-γ and LPS treatment or to an M2 phenotype by IL-4 treatment. Changes in M1 or M2 markers induced by HGF-MET signaling were evaluated. Mechanisms responsible for alternations in the macrophage phenotype and intracellular metabolism were analyzed. Results: c-Met was expressed especially in M1 macrophages polarized by treatment with IFN-γ and LPS. In M1 macrophages, HGF-MET signaling induced the expression of Arg-1 mRNA and secretion of IL-10 and TGF-β1 and downregulated the mRNA expression of iNOS, TNF-α, and IL-6. In addition, activation of the PI3K pathway and inactivation of NFκB were also observed in M1 macrophages treated with HGF. The increased Arg-1 expression and IL-10 secretion were abrogated by PI3K inhibition, whereas, no changes were observed in TNF-α and IL-6 expression. The inactivation of NFκB was found to be independent of the PI3K pathway. HGF-MET signaling shifted the M1 macrophages to an M2-like phenotype, mainly through PI3K-mediated induction of Arg-1 expression. Finally, HGF-MET signaling also shifted the M1 macrophage intracellular metabolism toward an M2 phenotype, especially with respect to fatty acid metabolism. Conclusion: Our results suggested that HGF treatment not only promotes regeneration in epithelial cells, but also leads to tissue repair by altering M1 macrophages to an M2-like phenotype.

Vadim Makarov
Olga Riabova
Sean Ekins
Sergei Chepur

Influenza virus and coronaviruses continue to cause pandemics across the globe. We know have a greater understanding of their function. Unfortunately the number of drugs in our armory to defend us against them are inadequate. This may require us to think about what mechanisms to address. We now review the biological properties of these viruses, their genetic evolution and antiviral therapies that can be used or have been attempted. We will describe several classes of drugs such as serine protease inhibitors, heparin, and heparan sulphate receptor inhibitors, chelating agents, immunomodulators and many others. We also briefly describe some of the drug repurposing efforts which have taken place in an effort to rapidly identify molecules to treat patients with COVID-19. While we have a heavy emphasis on the past and present efforts, we also provide some thoughts about what we need to do to prepare for respiratory viral threats in the future.

Osteoarthritis (OA) is a chronic joint disease afflicting a substantial portion of the world's population with no currently available cure. Mesenchymal stem cell (MSC)-based therapies have been observed to have a mild beneficial effect in OA but the mechanism behind their action remains unclear. This study aimed to identify the lymphocytic response to a xenogeneic human umbilical cord-derived MSC-based cell therapy. A unilateral medial meniscal release model was employed in an ovine model of post-traumatic OA, with the contralateral limb employed as the control. A dose of 1.0 × 10⁷ MSCs was administered to a subset of the OA group as well as to a normal sham-operated group. Synovial fluid was aspirated periodically for 13 weeks for flow cytometry analysis. At the termination of the study the stifle joints were collected and analyzed for potential pathologic changes. Cell therapy induced a transient influx of CD4⁺ leukocytes; there was a similar significant increase in the proportion of CD4⁺CD25⁺ and CD4⁺CD25hi leukocytes in response to cell therapy, the latter being a subset that may be composed of regulatory T cells. There was no significant effect of the cell therapy treatment on the proportion of synovial fluid-derived CD8⁺ cells or BAQ44A⁺ B cells. iNOS expression of intimal lining macrophages was evident but reduced in the cell therapy OA group suggesting macrophage phenotype transformation. There were no inflammatory or histological changes that could be attributed to the cell therapy. Cell therapy induced chemotaxis of CD4⁺ cells to the joint but these cells were not associated with pathological changes, despite their expression of activation markers (CD25⁺).

Rui Deng
Shi-Min Wang
Tao Yin
Yu Quan Wei

The universal organic solvent dimethyl sulfoxide (DMSO) can be used as a differentiation inducer of many cancer cells and has been widely used as a solvent in laboratories. However, its effects on breast cancer cells are not well understood. The aim of this study is to investigate the effect and associated mechanisms of DMSO on mouse breast cancer. We applied DMSO to observe the effect on tumors in a mouse breast cancer model. Tumor-associated macrophages (TAMs) were tested by flow cytometry. Ex vivo tumor microenvironment was imitated by 4T1 cultured cell conditioned medium. Enzyme-linked immunosorbent assays were performed to detect interleukin (IL)-10 and IL-12 expression in medium. To investigate the cytotoxicity of DMSO on TAMs, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays were performed. We found that DMSO produced tumor retardation when injected into mouse peritoneal cavities in a certain concentration range (0.5-1.0 mg/g). Furthermore, as detected by flow cytometry, TAM subtypes were found to be transformed. We further imitated a tumor microenvironment in vitro by using 4T1 cultured cell conditioned medium. Similarly, by using low concentration DMSO (1.0%-2.0% v/v), TAMs were induced to polarize to the classically activated macrophage (M1-type) and inhibited from polarizing into the alternatively activated macrophage (M2-type) in the conditioned medium. IL-10 expression in tumors was reduced, while IL-12 was increased compared with the control. Furthermore, we reported that 2.0% (v/v) DMSO could lead to cytotoxicity in peritoneal macrophages after 48 hours in MTT assays. Our findings suggest that DMSO could exert antitumor effects in 4T1 cancer-bearing mice by reversing TAM orientation and polarization from M2- to M1-type TAMs. These data may provide novel insight into studying breast cancer immunotherapy.

R.J. Jones

AT THE suggestion of its Advisory Panel on Medical Aspects of Sports, the Council on Scientific Affairs requested a staff report on the current status of and controversy about the use of dimethyl sulfoxide (DMSO). In recent years, much controversy has been generated over the question of the safety and efficacy of DMSO; DMSO has been proclaimed in the media as a wonder drug, a miracle drug, and a medical panacea. However, it also has been suggested that it is a hoax. The published information on the properties, actions, and uses of DMSO is abundant. It includes thousands of scientific articles from all over the world; several books; proceedings of at least four international conferences, two of which were convened by the New York Academy of Sciences; and the report of an ad hoc committee of the National Academy of Sciences. In addition, hearings of two congressional committees, innumerable articles

Edward E. Rosenbaum

Recent discovery that dimethyl sulfoxide (DMSO), a versatile commercial solvent, possesses unique medicinal properties opens up a new and rewarding field of pharmacotherapeutics. Dimethyl sulfoxide was first synthesized in 1867. Today, it is available in crude form as a by-product of the paper pulp industry, and during the past five years it has found extensive use as an industrial solvent. Its value in protecting biologic specimens against freezing damage is well known. Several years ago one of the authors (S.J.) of this paper consulted another (R.H.) relative to obtaining dimethyl sulfoxide for protecting surgically removed kidneys and hearts against freezing damage prior to transplantation. On this occasion one author mentioned that he had observed that DMSO enhanced the penetration of dyes into human skin and possessed the property of rapid absorption through the bark or roots of trees and plants. It had been noted that DMSO enhanced the penetration of

Mast cells are innate immune effector cells that reside in the healthy synovial sublining and expand in number with inflammation. These cells can play an important role in initiation of arthritis, but much about their biology and importance remains obscure. This chapter reviews the use of animal models for the study of mast cells in arthritis, with a particular focus on the K/BxN serum transfer model. We discuss tissue preparation and histological analysis for the assessment of joint inflammation, injury, and the presence and phenotype of synovial mast cells, as well as the use of bone marrow-derived mast cell (BMMC) engraftment into W/Wv mice as a tool to isolate the role of mast cells in joint inflammation and injury.

Huijeong Ahn
Jee Young Kim
Eui-Bae Jeung
Geun-Shik Lee

Dimethyl sulfoxide (DMSO) is an amphipathic molecule that is commonly/widely used as a solvent for biological compounds. In addition, DMSO has been studied as a medication for the treatment of inflammation, cystitis, and arthritis. Based on the anti-inflammatory characteristics of DMSO, we elucidated the effects of DMSO on activation of inflammasomes, which are cytoplasmic multi-protein complexes that mediate the maturation of interleukin (IL)-1β by activating caspase-1 (Casp1). In the present study, we prove that DMSO attenuated IL-1β maturation, Casp1 activity, and ASC pyroptosome formation via NLRP3 inflammasome activators. Further, NLRC4 and AIM2 inflammasome activity were not affected, suggesting that DMSO is a selective inhibitor of the NLRP3 inflammasomes. The anti-inflammatory effect of DMSO was further confirmed in animal, LPS-endotoxin sepsis and inflammatory bowel disease models. In addition, DMSO inhibited LPS-mediating IL-1s transcription. Taken together, DMSO shows anti-inflammatory characteristics, attenuates NLRP3 inflammasome activation, and mediates inhibition of IL-1s transcription.

Oxidative stress is considered to be critically involved in the normal aging process but also in the development and progression of various human pathologies like cardiovascular and neurodegenerative diseases, as well as of infections and malignant tumors. These pathological conditions involve an overwhelming production of reactive oxygen species (ROS), which are released as part of an anti-proliferative strategy during pro-inflammatory immune responses. Moreover, ROS themselves are autocrine forward regulators of the immune response.

Maya Muir

Dimethyl sulfoxide (DMSO), a by-product of the wood industry, has been in use as a commercial solvent since 1953. It is also one of the most studied but least understood pharmaceutical agents of our time--at least in the United States. According to Stanley Jacob, MD, a former head of the organ transplant program at Oregon Health Sciences University in Portland, more than 40,000 articles on its chemistry have appeared in scientific journals, which, in conjunction with thousands of laboratory studies, provide strong evidence of a wide variety of properties. (See Major Properties Attributed to DMSO) Worldwide, some 11,000 articles have been written on its medical and clinical implications, and in 125 countries throughout the world, including Canada, Great Britain, Germany, and Japan, doctors prescribe it for a variety of ailments, including pain, inflammation, scleroderma, interstitial cystitis, and arthritis elevated intercranial pressure. Yet in the United States, DMSO has Food and Drug Administration (FDA) approval only for use as a preservative of organs for transplant and for interstitial cystitis, a bladder disease. It has fallen out of the limelight and out of the mainstream of medical discourse, leading some to believe that it was discredited. The truth is more complicated.

Posted by: marcomarchante0209589.blogspot.com

Source: https://www.researchgate.net/publication/299538602_DMSO_Represses_Inflammatory_Cytokine_Production_from_Human_Blood_Cells_and_Reduces_Autoimmune_Arthritis

Marco Marchant

dmso natures healer pdf free download

Post a Comment for "dmso natures healer pdf free download"

Menu Halaman Statis